《外文翻译-- Application of Agilent 2100 Bioanalyzer in Multiplex PCR forDetection of Foodborne Pathogens》由会员分享，可在线阅读，更多相关《外文翻译-- Application of Agilent 2100 Bioanalyzer in Multiplex PCR forDetection of Foodborne Pathogens（4页珍藏版）》请在金锄头文库上搜索。
1、Application of Agilent 2100 Bioanalyzer in Multiplex PCR for Detection of Foodborne Pathogens* WANG Bo-fei1, BAI Yan-hong1, ZHAO Pei-pei1, WANG Yun-long2, JING Jian-zhou1* (1. College of Food Biotechnology Engineer, P.R Zheng Zhou University of Light Industry, Zhengzhou Henan 450002, P.R China; 2. H
2、enan Bioengineering Technology Research Center, Zhengzhou Henan 450002, P.R China) E-mail address:wbf_ AbstractTo explore the feasibility of using Agilent 2100 Bioanalyzer in the detection of the three kinds of food-borne pathogens, three pairs of primers were designed according to invA gene of Salm
3、onella ipah gene of Shigella and inv gene of Yersinia pseudotuberculosis, and then the single PCR was performed to detect specificity. Those genes were amplified by Multiplex PCR technique using specific primers, and the optimum of multiplex PCR reaction conditions. The multiplex PCR detection metho
4、d which provided a basis for further research on developing the food-borne pathogens detection kit was very practical. Agilent 2100 Bioanalyzer combined with Multiplex PCR was specific, accurate and sensitive for foodborne pathogens Salmonella, Shigella and Yersinia pseudotuberculosis detection. Key
5、words-Food-borne Pathogens; Multiplex PCR; Agilent 2100 Bioanalyzer; Testing Method I. INTRODUCTION Salmonella, Shigella and Yersinia pseudotuberculosis contamination is one of the most commonly reported causes of food-borne disease in the world1. Detection of pathogenic bacteria present mainly reli
6、es on conventional microbiological methods, which normally takes 4 7 d time. Another applications, such as immunoenzyme test, immunofluorescence assay, gene probe are relatively low sensitivity, poor specificity, and they are difficult to promote2. Agilent 2100 Bioanalyzer is an analytical system of
7、 nucleic acid for laboratory, which is industrial and with the biological chip as the base, and which overcomes the traditional limitations of gel electrophoresis3-5. Multi-PCR in the same PCR reaction system by adding more pairs of primers can amplify a number of target gene. 6 In pathogen detectio
8、n, the multiple PCR can not only enhance the detection efficiency, but also save the cost of the detection. In this paper, as for the common food-borne pathogens, such as Salmonella, Shigella and Yersinia Pseudotuberculosis were detected by the multiple PCR and Agilent 2100 Bioanalyzer at the same t
9、ime. The aim of the study was to find and verify a new pathogens testing method. II. MATERIALS AND METHODS A. Materials and Reagents Pathogens: typhimurium(GIM1.237), Salmonella paratyphi-A(GIM1.235), Salmonella paratyphi-B(GIM1.224), Salmonella spp.(CGMCC1.1552), Shigella spp.-A(GIM1.238). Shigella
10、 spp.-B(GIM1.239), Shigella spp. - C(CMCC51252), Yersinia Pseudotuberculosis(GIM1.267), bought from Guangzhou province microorganism fungiform conserve center and Chinese microorganism fungiform conserve center. Primers of PCR were showed as table 1. Primer sequences 7： Tab. 1 Result of primer desig
11、n of PCR Pathogens Target gene PCR Primer sequences (5-3) Salmonella spp. invA gene Sal-3a,TATCGCCACGTTCGGGCAA Sal-4a,TCGCACCGTCAAAGGAACC 275bp Shigella spp. ipah gene Shi-1a,CTTGACCGCCTTTCCGATAC Shi-2a,CAGCCACCCTCTGAGAGTA 610bp Yersinia Pseudotuberculosis inv gene YP-3a,CTTGGCTGATGGCACGAT YP-4a,TCG
12、TCACCTGACCCTGAT 440bp Primer sequences were compounded by shanghai Bioengineering Corporation. 7500 LabChip kit was offered by Agilent Technologies, each reagent kit with 25 chips and reagents below: gel ground substance, coloration concentrated liquid, maker, ladders and so on. 12 samples could be
13、detected by one chip each time. B. Instruments Agilent 2100 Bioanalyzer and the Related software were bought from Agilent Technologies and were used for the separation with the gene chip as an aid. Gradient PCR instrument: PCYL220, U.S. company Thermo Gel Imaging System: Omega10, U.S. ULTRA. LUM .In
14、c. C. Experimental procedures 1) Template Preparation Bacterial DNA was extracted by Chelex-100 Chelex-100 was used as an ion-chelating agent, composed of styrene and Diethylene benzene. Its suspension in the alkaline environment (pH10 11) and under the conditions of 100 could lead to the breakdown
15、of cell membranes and the variability and release of DNA8,9. (1) The sample was added to 1.5 mL centrifuge tube with 500 L water, then was vibrated Violently, placed at room temperature for 15 min. (2) Centrifuged for 3min at 13,000 rpm, the supernatant was removed, the pellets were collected. (Dist
16、illed water could be used repeatedly, if necessary, to wash sediment until colorless or very little pigment). Corresponding author. JING Jian-zhou Address: College of Food and Biological Engineering, Zhengzhou University of Light Industry, Dongfeng Road #5, Zhengzhou, Henna, 450002, P.R, China E-mai
17、l address: U.S. Government work not protected by U.S. copyright(3) The pellet was suspended in200 L 5% Chelex-100 solution(5% Chelex-100 which was the suspension, must be shook before used, so that particles could be suspended), shook repeatedly, then stored for 30 min at 56. (4) Shook and kept for
18、 8 min at 100, then shook and centrifuged for 3min at 13,000 rpm, the supernatant was used for PCR amplification, or preserved at 4. 2) Optimum of triple-PCR reaction conditions Salmonella, Shigella and Yersinia Pseudotuberculosis were used as templates, to optimize the reaction conditions of the mu
19、ltiple PCR. The initial reaction conditions (25 L) included 10 PCR buffer 2.5 L, 25 mmol / L Mg2 + 1.6 L, 2.5 mmol / L dNTP 2.0 L, 2.0 mol / L three pairs of primer 1.0 L separately, 3 U / L Taq DNA polymerase 0.5 L. And then had optimization studies on the PCR annealing temperature, Mg2+ concentrat
20、ion, primer concentration. 3) Specific primers Standard strains from Salmonella, Shigella and Yersinia Pseudotuberculosis were used as templates for DNA-specific PCR. The optimized results of the above PCR considered as reaction conditions. 4) Triple PCR sensitivity Three types of standard strains（S
21、almonella, Shigella and Yersinia pseudotuberculosis）were cultured to logarithmic phase. The LB agar plate was used to count the strains, 108 cfu, were diluted with ultra-pure water to 108 times. Centrifuged 7,000 rpm 20 min, Chelex-100 was used to extract DNA. PCR items: 94, 5min; 94, 30s; 63, 50s;
22、72, 30min; 30cycles; 72, 5min. 5) Agarose gel electrophoresis analysis 6l PCR production above was used for 1.5% agarose gel electrophoresis, 60V, 1h, and then results were taken a picture and analyzed amplified production according to the length relevant production. 6) Chip Detection and Analysis E
23、verything was done according to DNA 7500 LabChip Kit introductions. Gel and dyestuff compound were prepared as: 400l gel ground substance mixed with 20l concentrated dyestuff was filtrated by centrifugal filtrated machine. Gel and dyestuff compound were pouring in the chip and 5l marker were added t
24、o each sample well. After PCR amplification 1l of each reaction was loaded into 12 wells chip (DNA 7500 LabChip Kit), then 1l ladder was added to the appointed ladder well. Finally during vortexing chips were mixed well and inserted in the Agilent 2100 Bioanalyzer within 5 minutes for detection and
25、analysis automatically. III. RESULTS AND ANALYSIS A. Optimum of triple-PCR reaction conditions Shigella spp. was used as template. PCR annealing temperature, Mg2+ concentration and primer concentration were optimized. As figures 1, 2 and 3 showed that the best annealing temperature for PCR reaction
26、was 63 , the optimum Mg2 + concentration was 1.6 mmol / L, the best primer concentration of Salmonella, Shigella and Yersinia Pseudotuberculosis was 120 nmol / L, 80 nmol / L and 80 nmol / L, respectively. B. Primer Specificity In the above-mentioned conditions optimization of PCR, extracted DNA 14
27、strains of bacteria was amplified with three pairs of designed primers, special character of primers was detected. The results showed that the length of four kinds of Salmonella spp. amplified fragment were 275 bp, the length of three kinds of Shigella spp. amplified fragment were 610 bp, the length
28、 of Yersinia Pseudotuberculosis amplified fragment were 440 bp. Primers had no cross-reaction. Fig. 1 Effect of anneal temperature for multiplex PCR M：DNA Maker，14 anneal temperature：57、59、 61、63 Fig. 2 Effect of Mg2+ concentration for multiplex PCR M：DNA Maker，16 Mg2+：0、0.4mmol/L、0.8mmol/L、1.6mmol/
29、L、2.0mmol/L、2.4mmol/L Fig. 3 Effect of primer concentration for multiplex PCR M：DL1000，15：three pairs of same amount primers 10nmol/L、40nmol/L、80nmol/L、120nmol/L、160nmol/L；6： 120nmol/L、80nmol/L、80nmol/L Fig. 4 1.5% Agarose Gel Electrophoresis Chart of PCR Amplified Segments of 14 Pathogens DNA M：DNA
30、 Maker；1：Salmonella typhimurium；2：Salmonella paratyphi-A；3：Salmonella paratyphi-B；4：Salmonella spp.；5：Shigella flexneri ；6：Shigella sonnet ；7：Shigella dysenteriae；8：Listeria monocytohenes；9：Listeria welshimeri；10：Yersinia enterocolitica；11：Yersinia Pseudotuberculosis；12：Staphylococcus aureus subsp.
31、Aureus Rosenbach-a；13：Staphylococcus aureus subsp. Aureus Rosenbach-b；14：Staphylococcus aureus; 15：Blank control Fig. 5 1.5% Agarose Gel Electrophoresis Chart of PCR Amplified Segments of 14 Pathogens DNA M: DNA Maker; 1: Shigella bacteria; 2: Song Shigella; 3: Shigella dysenteriae; 4: Salmonella ty
32、phimurium; 5: Salmonella paratyphoid fever; 6: Vice-B Salmonella typhimurium; 7: Salmonella; 8: L. monocytogenes; 9: Wills Listeria monocytogenes; 10: Yersinia enterocolitis; 11: Yersinia Pseudotuberculosis; 12: golden yellow grapes Staphylococcus aureus subspecies of a; 13: Staphylococcus aureus su
33、bspecies aureus b; 14: Staphylococcus aureus; 15: blank control Fig. 6 Agarose Gel Electrophoresis Chart of PCR Amplified Segments of 14 Pathogens DNA M: DNA Maker;1: Yersinia Pseudotuberculosis; 2: Salmonella typhimurium; 3: Salmonella paratyphoid fever;4:Salmonella paratyphi B; 5: Salmonella; 6: S
34、higella bacteria; 7: Song Shigella; 8:Shigella dysenteriae; 9:L.monocytogenes; 10:WillsListeria monocytogenes; 11: Yersinia enterocolitis; 12: golden yellow grapes Staphylococcus aureus subspecies of a; 13:Staphylococcus aureus subspecies aureus b; 14: Staphylococcus aureus; 15:blank control C. The
35、sensitivity of PCR triple 108 cfu of Salmonella, Shigella and Yersinia Pseudotuberculosis, was diluted by 10-fold dilution gradient with ultrapure water respectively. The bacterial content for the reaction were 108cfu, 107cfu, 106cfu, 105cfu, 104cfu, 103cfu, 102cfu, 101cfu and 100cfu ， respectively,
36、 with using Chelex-100 to extract DNA. Then the triple-PCR was used under the optimized conditions, the product of electrophoresis results were showed in figure 7, Figure 8 and Figure 9. In gel electrophoresis, after triple-PCR, the sensitivity of Salmonella, Shigella and Yersinia Pseudotuberculosis
37、 were 103cfu, 103cfu and 103cfu ingel electrophoresis. D. PCR product detection and analysis with Bioanalyzer 1) Comparison of Accuracy and Repeatability between Bioanalyzer and Agarose Gel Electrophoresis As figure 4, figure 5, figure 6 figure 10 and figure 11 showed that the detection methods were
38、 able to detect the fragments. Otherwise, there was a little error between the size through testing and the actual size of the fragments. In figure 11, by comparing the length of the fragment between test and actual, the length of fragments detected by Bioanalyzer was 278 bp, 452 bp, 623 bp, respect
39、ively. The actual length was and 275 bp, 440 bp and 610 bp, respectively. Error rate between them was 1.8%, 2.7% and 2.1%, which was within the report margin of error of less than 5%. The results Agarose gel electrophoresis could only be used as a visual estimate of the size of fragment, and the err
40、or rate was 15%. On the right of figure 11, there was a gel-like image corresponding to the peaks, which made it easier to be observed and analyzed. Fig. 7 Sensitivity of multiplex PCR assay for detection of Salmonellas DNA M：DL1000，19：108cfu、107cfu、106cfu、105cfu、104cfu、103cfu、102cfu、101cfu、100cfu F
41、ig. 8 Sensitivity of multiplex PCR assay for detection of Shigellas DNA M：DL1000，19：108cfu、107cfu、106cfu、105cfu、104cfu、103cfu、102cfu、101cfu、100cfu Fig. 9 Sensitivity of multiplex PCR assay for detection of Yersinia Pseudotuberculosis DNA M：DL1000，19：108cfu、107cfu、106cfu、105cfu、104cfu、103cfu、102cfu、1
42、01cfu、100cfu Fig. 10 Gel Chart of PCR Amplified Segments of multiplex PCR with Bioanalyzer L：ladder，1: Water as a negative control; 2: Salmonella spp.; 3: Yersinia Pseudotuberculosis; 4: Shigella spp.; 5: Salmonella spp. and Yersinia Pseudotuberculosis; 6: Salmonella spp. and Shigella spp.; 7: Shige
43、lla spp. and Yersinia Pseudotuberculosis; 8: Salmonella spp., Shigella spp. and Yersinia Pseudotuberculosis Fig. 11 Chart of Amplified Segment of multiplex PCR with Bioanalyzer 2) Comparison of Sensitivity between Bioanalyzer and Agarose Gel Electrophoresis From figure 7, figure 8, figure 9 and figu
44、re 12 showed that the sensitivity of multiplex PCR with assay with Bioanalyzer for detection of Salmonella, Shigella and Yersinia Pseudotuberculosi was 102cfu. The sensitivity of Agarose Gel was 103 cfu. The Sensitivity of Bioanalyzer was 10 times than that of Agarose Gel. Fig. 12 Sensitivity of mul
45、tiplex PCR assay for detection of Salmonella、Shigella、Yersinia Pseudotuberculosis DNA M：DL1000，19：100cfu、101cfu、102cfu、103cfu、104cfu、105cfu、106cfu、107cfu、108cfu IV. DISCUSSIONS PCR detection for pathogens is rapid, sensitive and specific, respectically in the process of detection the environment of
46、the sample is important for detection. Foods are complex substances. Varieties of factors which have an impact on food safety must be taken into account. In the actual food testing, there is a very small number of positive samples which can be used to confirm in the conventional methods. On the othe
47、r hand, the pathogen content of the samples are generally small and a large number of PCR inhibitors exist in the samples, which are severely affected the PCR amplification results, false-negative results. Therefore, to find effective methods of sample pre-treatment, the bacteria-rich samples, the e
48、xistence of the samples to remove PCR inhibitors, can greatly increase the food-borne pathogens in the practicality of PCR detection methods10. Therefore recommended that in practice, firstly used multiple PCR method for screening samples, and then combined with the national standard method to verif
49、y, thereby reduced the workload and improved efficiency. In this study, by optimizing the PCR reaction conditions, the triple-PCR system about rapid detection of Salmonella, Shigella and Pseudotuberculosis had the merits of specificity, sensitivity, time saving and steps simplifying. The minimum det
50、ection limit could reach 1 cfu. The entire detection time was less than 20 h, with a strong application. After further standardize, test kits will be developed so as to lay the foundation for the popularization and application of food-borne pathogenic micro-organisms detection kit. Bioanalyzer combi
51、ned with multi-chip PCR method had an important exercisable value in detecting and identification of food-borne pathogens and was worth popularizing. 1 F. S. Chen, Z. X. Gao, J. H. Wang . Food Safety Inspection and modern biotechnology M. Beijing, Chemical Industry Press, 2004. 2 Q. P. Wu, H. Y. Fan
52、, J. M. Zhang. New Research On Immune and Molecular detection of Food-borne pathogenJ. Food science, 2005，26(11)：269-273. 3 C. Liu, W. Ma, R. Shi. “Application of Agilent 2100 Bioanalyzer in detection of human papilloma virus,” J First Mil Med Univ, vol. 23, .213-215, March 2003. 4 R. M. Brena, H. A
53、uer, K. Kornacker. Accurate quantification of DNA methylation using combined bisulfite restriction analysis coupled with the Agilent 2100 Bioanalyzer platformJ. Nucleic Acids Res, 2006,34(3) 5 I. Nachamkin, N. J. Panaro, M. Li. Agilent 2100 Bioanalyzer for restriction fragment length polymorphism an
54、alysis of the Campylobacter jejuni flagellin geneJ. Journal of Clinical Microbiology, 2001,39(2):754-757. 6 Y. P. Xu, W. Cheng, F. S. Chen. Multiple PCR technology in the food-borne pathogenic bacteria detection J. Food Science, 2007,28 (2) :355-359. 7 R. F. Wang, W. W. Cao, C. E. Cerniglia. A unive
55、rsal protocol for PCR detection of 13 species of foodborne pathogens in foodsJ. Journal of Applied Microbiology, 1997,83(6):727-736. 8 Singer-Sam J，Tangua RL，Riggs AD. Use of Chelex to improve the PCR signal from a small number of cellsJ. Amplification，1989，3(1):11-16. 9 N. J. Coombs，A. C. Gough，J. N. Primrose. Optimisation of DNA and RNA extraction from archival formalin-fixed tissueJ. Nucleic Acids Research，1999，27(16). 10 X. K. Xu, Q. P. Wu, J. M. Zhang. Research on PCR detection of food-borne pathogens, Microbiology briefing, 2007,34 (5) :970-97
