《外文翻译--Bioinformatics Analysis of Nitrite Reducate from Pseudomonas aeruginosa HGP9 and the Structure Prediction with Homology Modeling》由会员分享，可在线阅读，更多相关《外文翻译--Bioinformatics Analysis of Nitrite Reducate from Pseudomonas aeruginosa HGP9 and the Structure Prediction with Homology Modeling（4页珍藏版）》请在金锄头文库上搜索。
1、Bioinformatics Analysis of Nitrite Reducate from Pseudomonas aeruginosa HGP9 and the Structure Prediction with Homology Modeling Yongliang Zheng 1,2, Zhonghua Wu 1, Jianping Gan 1, Jianping Fang1, Shiwang Liu1 , Deli Liu 2，Yuling Zhong1* 1. College of Life Science and Engineering, Huanggang Normal u
2、niversity, 146 Xingang II Road, Huangzhou, 438000, China 2. College of Life Science, Central China Normal University, Wuhan 430079, China D Abstract Nitrite reductase (nirS) is a key enzyme of denitrification catalyzing the one electron reduction of nitrite (NO2-) to nitrogen monoxide (NO).In this
3、study, nirS gene was cloned from Pseudomonas aeruginosa HGP9 strain. The phylogenetic tree was constructed and the secondary structure was predicted by bioinformatics. Results showed that nirS gene was 99.8% similar to the nitrite reductase from Pseudomonas aeruginosa NCTC 6750 strain. Most of alpha
4、-helices stretches are formed in the first 1/4 of the sequence and the beta-sheets are present in the last 3/4 sequences. Homology modeling based on using nitrite reductase (PDBID: 1gjqA ) as template for nirS indicated that two independent subunits comprised a homodimer in nirS crystal structure, a
5、nd each monomer is composed of a c-heme domain and a d1-heme domain. both of them are cytochrom super family. Compared to the three-dimensional structure of nirS, there was a nature mutation in nirS that located the site residue of Phe109 in P. aeruginosa HGP9 strain (the residue was Thr84 in P. aer
6、uginosa NCTC 6750 strain), and the mutation site was in the heme c domain. Keywords Nitrite reductase; Pseudomonas aeruginosa; crystal structure; Homology modeling I. INTRODUCTION Denitrification is the process by which denitrifying bacteria reduce nitrate to molecular nitrogen. Bacterial denitrific
7、ation is an anaerobic respiration to use nitrogenous oxides as terminal electron acceptors. The metabolic pathways for processing N-oxianions in environment are complex, both in redox enzymes and necessary control elements 1,2. Each of the four steps in nitrate reduction is catalysed by a unique enz
8、yme, which named after their substrate: nitrate, nitrite, nitric oxide and nitrous oxide reductase, respectively3,4. The genes required for denitrification are considerably conserved across species in clusters, although some important differences in gene location and factor requirement were found. M
9、any of the denitrification genes so far have been cloned and expressed in an E.coli expression system 5. Nitrite reductase (abbrevi -ated as nirS or NiR, EC 1.6.6.4) is a key enzyme of denitrification, which catalyses the one electron reduction of nitrite (NO2- ) to nitrogen monoxide (NO) within the
10、 bacterial denitrification process, and it was widely discovered and identified in many different strains such as Alcaligenes, Thiobacillus, Thiosphaera and Pseudomonas (Table1). Pseudomonas are well-characterised gram-negative prokaryotes among which these strains sustain denitrification 5,6. In th
11、is article, nirS gene was cloned from a novel phenol degradation bacterium P. aeruginosa HGP9.The sequence was analysis and the protein structure was predicted with bioinformatics methods and Homology modeling. II. MATERIALS AND METHODS A. Materials The wide-type bacterial strain P. aeruginosa HGP9
12、(FJ897846), which is capable of degradation phenol as the sole source of carbon, nitrogen and energy, was originally isolated from the sludge sampled in a chemical factory. The fragments of the nirS gene were amplified using the Pseudomonas aeruginosa NTCC 6750 strain genomic DNA as template and pri
13、mers designed based on nitrite reductase gene sequence (accession number is P24474),the PCR Primers were as: P1 (5- GGAATTCATGGACGGCGAGACCCTGGAAC * Corresponding author, Email: 978-1-4244-4713-8/10/$25.00 2010 IEEE C-3) and P2 (5 CCCAAGCTTCGAGCAGCGAAAGCAG TGCGTACGG-3). The amplified DNA was inserted
14、 into a pMD18-T vector and sequenced. B. Sequence analysis and the secondary structure prediction The nirS gene identity and phylogenetic similarity of corresponding genes were analyzed using the software of ClustalW and MEGA4.1 based on the online blast. The secondary structure of nirS protein was
15、predicted severally on GOR (http:/npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page =npsa_gor4.html) and APSSP Server (http:/imtech.res.in/ raghava/apssp/) respectively, and multi-sequence analyzed by JOY7,8. C. Homology modeling The homology proteins of nirS from various bacterial genomes were blasted
16、 in Expasy web (http:/www.expasy.ch). Homology modeling was done using the program Esypred3D 9(http:/www.fundp.ac.be/sciences/biologie/urbm/bioinfo/esy-pred/).The Nitrite reductase that PDB identifier 1gjqA was used as template for the homology modeling. III. RESULTS AND DISCUSSION A. PCR amplificat
17、ion of nirS and phylogenetic similarity analysis The nirS gene of 1704 bp length was amplified from genomic DNA of P. aeruginosa HGP9 (Fig.1). It was sequenced and submitted to GenBank (accession number: GU123692). The open reading frame (ORF) was analyzed with DNAman (Ver 6.0.3.48). Results indicat
18、ed that nirS gene from the strain HGP9 was 99.8% similarity to nitrite reductase gene from the strain P. aeruginosa NCTC 6750(Fig.2), and they are both belonged to nitrite reductase family. NirS gene encodes a protein of 568 amino acids and contains one ORF. There are three nucleotides which have be
19、en mutated naturally in the nucleotide sequence comparing to nirS gene sequence from Pseudomonas aeruginosa NCTC 6750. B. The secondary structure prediction of NirS protein Analysis of the protein sequence in terms of hydrophobicity and secondary structure provides preliminary information of some in
20、terest. Predicting the secondary structure of proteins leads to an understanding of the components that make up a whole protein. In this study, the secondary structure prediction was carried out. Results showed that the amount of alpha-helices is 178 and the percent alpha-helix of this region is cal
21、culated at 31.34%, as well as TABLE I. THE NITRITE REDUCTASE BLASTED ON EXPASY Protein name Accession Source Length (AA) Identity Nitrite reductase P24474 Pseudomonas aeruginosa (strain NTCC 6750) 568 99% Nitrite reductase B7V4A5 Pseudomonas aeruginosa (strain LESB58) 568 99% NirS protein Q76KD7 Bur
22、kholderia cepacia. 568 99% Nitrite reductase C5IZJ3 Pseudomonas aeruginosa (strain DBT1BNH3) 443 99% Nitrite reductase A6UYY0 Pseudomonas aeruginosa (strain PA7) 568 98% Cd1 nitrite reductase Q9F0W9 Pseudomonas fluorescens (strain C7R12) 559 81% Cytochrome c Q2SE04 Hahella chejuensis (strain KCTC 23
23、96) 594 71% Nitrite reductase (NO-forming) Q3SML5 Thiobacillus denitrificans (strain ATCC 25259) 575 69% Cytochrome cd1 nitrite reductase Q5P7W3 Azoarcus sp. (strain EbN1) 578 67% Hydroxylamine reductase C5T1B6 Acidovorax delafieldii 2AN 577 65% Nitrite reductase A7C054 Beggiatoa sp. PS. 583 66% ext
24、ended strand is 120 and 21.13%, and random coil is up to 270 and 47.54% percentage. The alpha-helix stretches are appeared in the first 1/4 of the sequence; on the other hand, most of the beta-sheets are present in the last 3/4 of the sequence. Figure 1. PCR product of nirS from P. aeruginosa HGP9.
25、Lane 1: DL5000 DNA Marker; Lane 2: nirS gene. Figure 2. Phylogenetic analysis of nirS gene from P. aeruginosa HGP9 C. The crystal structure analysis of nirS protein with homology modeling Homology modeling can be used to predict corresponding functional residues in the modeled protein using the temp
26、late for which the structure has been resolved. Results show that the structure of nirS is consisted of a homodimer (Fig.3a), in which the monomers carry a c-heme domain and a d1-heme domain, and both of them are cytochrom super family. Each monomer contained two redox centers within separate domain
27、s: one heme c prosthetic group covalently linked to the polypeptidic chain and one heme d1 moiety noncovalently associated with the protein (Fig.3b). Compared with the three-dimensional structure of nirS, there is a nature mutation in nirS that located the site residue of Phe109 in P. aeruginosa HGP
28、9 (at the same site residue was Thr84 in P. aeruginosa NCTC 6750) (Fig.3c).The mutation site is in the heme c domain. The experiments were carried out to identify the change of the function of nirS due to the residue mutation and data are not showed. (a) (b) (c) Figure 3. The crystal structure predi
29、ction of nirS protein with homology modeling. (a) A cartoon represented the homodimer structure of nirS and a letter referred to the two monomers (A and B). (b) A cartoon representation of the monomers structure of nirS. The red and yellow show a c-type and a d1-type heme, respectively. The green is
30、 the ball and stick display of the mutation residue PHE109 at the site of heme c domain; (c) The ball and stick display of mutation residues THR84 from P. aeruginosa NCTC 6750 and PHE109 from P. aeruginosa HGP9 strains labeled in nirS. IV. CONCLUSION Nitrite reductase (nirS) gene was successful clon
31、ed from bacterium P. aeruginosa HGP9. Sequences analysis showed that nirS gene from the strain HGP9 was highly similarity to nitrite reductase gene from the strain P. aeruginosa NCTC 6750. The second structure prediction of nirS protein indicated that alpha-helices and beta-sheets are formed in diff
32、erent ranges of sequences. The three-dimensional structure of nirS was determined with homology modeling based on the bioinformatics analysis. nirS was consisted of a homodimer, and each monomer contains a c-heme domain and a d1-heme domain. One mutation residue Phe109 in P. aeruginosa HGP9 was foun
33、d compared to the same site of nirS from P. aeruginosa NCTC 6750, and the mutation residue was within the heme c domain. ACKNOWLEDGEMENT This project was supported by the Natural Science Foundation of China (20672041), the National Key Project for Basic Research of China (2007CB116302), Specialized
34、Research Fund for the Doctoral Program of Higher Education (20060511002), the Construction Fund for “211” Project of the Ministry of Education of China, the Key Technology R&D Program in Hubei Province (2007AA201C50), the Key Technology R&D Program in Wuhan (20062001018) and supported by the Major P
35、rogram of National Natural Science Foundation of Hubei Provincial Science & Technology Department of China (2004ABA148). REFERENCES 1 W. Y. Rick and M. T. Stuart, “Microbial nitrogen cycles: physiology, genomics and applications,” Ecology and industrial microbiology, Vol.4,pp.307312,2001 2 J. M. Bre
36、mner and A. M. Blackmer, “Nitrous oxide: emission from soils during nitrification of fertilizer nitrogen,” Science, vol. 199, pp. 295-296, Jan 1978. 3 M. K. Firestone, R. B. Firestone, and J. M. Tiedje, “Nitrous oxide from soil denitrification: factors controlling its biological production,” Science
37、, vol. 208, pp. 749-751, May 1980. 4 Y. Sachiko, N. Naohiro, T. Satoshi, H. Akira and I.Yuhei, “Salinity Decreases Nitrite Reductase Gene Diversity in Denitrifying Bacteria of Wastewater Treatment Systems.” Appl Environ Microbiol, Vol.70(5),pp. 31523157, May 2004. 5 A.Marzia,G.Z.Walter and G.Frances
38、ca, “Expression of a fully functional cd1 nitrite reductase from Pseudomonas aeruginosa in Pseudomonas stutzeri,” Protein Expression and Purification,Vol.27,pp.4248,2003. 6 W. Sun, M.Arese, M. Brunori, D. Nurizzo, K.Brown, C. Cambillau, M. Tegoni and F.Cutruzzola, “Cyanide Binding to Cd(1) Nitrite R
39、eductase from Pseudomonas Aeruginosa: Role of the Active-Site His369 in Ligand Stabilization.” Biochem.Biophys. Res.Commun, Vol.291: 1,pp.1-7, February 2002 7 K. Mizuguchi, C. M. Deane and T. L. Blundell, “JOY: Protein sequence-structure representation and analysis.” Bioinformatics, Vol.14 (7), pp.6
40、17- 623, 1998. 8 J. Garnier, J.F. Gibrat, B. Robson and R.F. Doolittle Ed., “GOR secondary structure prediction method version IV,” Methods in Enzymology, Vol 266, pp.540-553, 1996. 9 C. Lambert, N. Leonard, X. De Bolle and E. Depiereux. “ESyPred3D: Prediction of proteins 3D structures.” Bioinformatics, vol.18(9), pp.1250-1256, September 2002.
