《【病毒外文文献】2008 siRNA silencing of angiotensin-converting enzyme 2 reduced severe acute respiratory syndrome-associated coronavirus》由会员分享，可在线阅读，更多相关《【病毒外文文献】2008 siRNA silencing of angiotensin-converting enzyme 2 reduced severe acute respiratory syndrome-associated coronavirus（7页珍藏版）》请在金锄头文库上搜索。
1、ARTICLEsiRNA silencing of angiotensin-converting enzyme 2 reducedsevere acute respiratory syndrome-associated coronavirusreplications in Vero E6 cellsC.-Y. Lu&H.-Y. Huang&T.-H. Yang&L.-Y. Chang&C.-Y. Lee&L.-M. HuangReceived: 8 October 2007 /Accepted: 15 February 2008 /Published online: 1 May 2008#Sp
2、ringer-Verlag 2008Abstract The outbreak of severe acute respiratory syn-drome (SARS) in 20022003 has had a significant impactworldwide. No effective prophylaxis or treatment for SARSis available up to now. Angiotensin-converting enzyme 2(ACE2) is the cellular receptor for SARS-associated coro-naviru
3、s (SARS-CoV). By expressing a U6 promoter-drivensmall interfering RNA containing sequences homologous topart of ACE2 mRNA, we successfully silenced ACE2expression in Vero E6 cells. By detecting negative strandSARS-CoV RNA and measuring RNA copy numbers ofSARS-CoV by real-time reverse transcription p
4、olymerasechain reaction (RT-PCR), we demonstrated that SARS-CoVinfection was reduced in the ACE2-silenced cell lines. Thesefindings support the involvement of ACE2 in SARS-CoVinfections and provide a basis for further studies on potentialuse of siRNA targeting ACE2 as a preventive or therapeuticstra
5、tegy for SARS.IntroductionThe outbreak of severe acute respiratory syndrome (SARS)in 20022003 affected over 8,000 individuals and wasresponsible for almost 800 deaths (WHO, 2004). It alsocaused significant psychological and economic impactsworldwide 1, 2. Although the SARS epidemic wasstopped in mid
6、-2003, the potential threat of SARS willremain high as long as no effective prevention or treatmentfor SARS is available.Spike proteins of SARS-associated coronaviruses (SARS-CoV) interact with cellular receptors to mediate the infectionof their target cells 3. By using immunoprecipitation, Li etal.
7、 identified a metallopeptidase, angiotensin-convertingenzyme 2 (ACE2), as the cellular receptor for SARS-CoV4. ACE2 is expressed mainly in the heart and kidneys butis also found in the bronchi and lungs 5, 6, where the majorpathology of SARS resides.RNA interference (RNAi) is a cellular process wher
8、einshort, double-stranded RNAs called small interfering RNAs(siRNAs)activateribonucleases totarget homologousmRNA7, 8. It has been used as a powerful tool for gene silencing.RNAi is also regarded as an antiviral strategy used by plantsand probably other organisms 9. Moreover, applications ofRNAi tec
9、hnologies in the treatment or prevention ofinfectious diseases are being tested extensively.The African green monkey kidney cell line Vero E6expresses ACE2 and permits the replication of SARS-CoV10. In this study, we tested the hypothesis that RNAitechnology can effectively eliminate ACE2, the cellu
10、larreceptor for SARS-CoV, from Vero E6 cells and blockSARS-CoV infections in these cells.Material and methodsPlasmidsPlasmids generating small hairpin RNAs that target ACE2mRNA were constructed using the vector pSilencer 2.1-U6neo (Ambion, Austin, TX, USA). The mRNA of ACE2(accession no. NM021804) w
11、as scanned for sequences ofEur J Clin Microbiol Infect Dis (2008) 27:709715DOI 10.1007/s10096-008-0495-5Part of the results was presented at the 184th Scientific Meeting of theTaiwan Pediatric Association (Taipei, 2006) and the 7th AnnualMeeting of the Infectious Disease Society of Taiwan (Taipei, 2
12、006).C.-Y. Lu (*):H.-Y. Huang:T.-H. Yang:L.-Y. Chang:C.-Y. Lee:L.-M. HuangDepartment of Pediatrics, National Taiwan University Hospital,No. 7, Chung-Shan South Road,Taipei, Taiwane-mail: cyluntuh.gov.twthe AAN19TT pattern. These sequences were all analyzedby BLAST search of the GenBank database. Seq
13、uenceswith more than 1617 contiguous base pairs of homologyto other coding sequences were excluded. Two mutuallycomplementary 64 oligonucleotides encoding small hairpinsequences targeting position 200222 of human ACE2mRNA (5-GATCCGCCACGAAGCCGAAGACCTGTTCAAGAGA CAGGTCTTCGGCTTCGTGGTTTTTTGGAAA-3 and 5-A
14、GCTTTTCCAAAAAACCACGAAGCCGAAGACCTGTCTCTTGAACAGGTCTTCGGCTTCGTGGCG-3) were synthesized, annealed, and ligatedto the BamHI/HindIII sites of pSilencer 2.1-U6 neo to makepSilencer-ACE2. The inserted sequences were confirmed bydirect sequencing.Establishment of ACE2-silenced stable cell linesThe African gr
15、een monkey kidney cell Vero E6 (CRL-1587) was purchased from the American Type CultureCollection (Manassas, VA, USA). All cell lines weremaintained in minimal essential medium with Earlesbalance salts (EMEM, JRH Biosciences, Lenexa, KS,USA) with 10% fetal bovine serum (FBS, BiologicalIndustries, Kib
16、butz Bet Haemek, Israel). Vero E6 cells(3105cells/well) were seeded into 6-well plates in EMEMwith 10% fetal calf serum 1 day before transfection in orderto get a 70% confluence at transfection. pSilencer-ACE2plasmids were transfected using Lipofectamine 2000(Invitrogen, Carlsbad, CA, USA) with a ra
17、tio of 4 ugDNA mix to 10 ul Lipofectamine 2000 per well, accordingto the manufacturers instructions. Transfection of the sameplasmids was repeated once 48 h later. The cells weresubcultured 24 h after the transfections, and then every 23daysincompletemediumcontaining2mg/mlG418(Sigma,St. Louis, MO, U
18、SA). The concentration of G418 wasreduced to 1 mg/ml 14 days later. The cells were then dilutedand single colonies were picked for further experiments.SARS virus infectionThe SARS-CoV strain TW1 2, which was isolated from aconfirmed SARS patient in the National Taiwan UniversityHospital, was used fo
19、r infection. The stock virus was grownin Vero E6 cells, titered, and frozen in aliquots at 80C.For quantitative analysis of SARS replication experiments,cells were grown to 8090% confluence (6105cells) in12-well culture plates and inoculated with serially dilutedSARS-CoV at multiplicity of infection
20、 (MOI) of 1, 101,102, and 103. During the infection process, G418 wasremoved from the medium for the ACE2-silenced cells. Forobservation of cytopathic effects, 101MOI of SARSviruses were inoculated to Vero E6 in 6-well plates. Thevirus were left in 200 ul EMEM with 2% FBS for 1 h foradsorption. Then
21、, the cells were washed and re-fed withEMEM containing 10% FBS. Cytopathic effects wereobserved and RNA extraction was done at different timepoints after infection. All experiments associated withinfectious SARS-CoV were carried out in a biosafety level3 laboratory in the National Taiwan University.
22、Western blottingCell lysates were colleted by cell lysis buffer (10 mM Tris,150 mM NaCl, 5 mM ethylenediaminetetraacetate, 1%NP40) premixed with protease inhibitor cocktail tablets(Roche, Penzberg, Germany), resolved by electrophoresiswith 8% SDS-polyacrylamide gel, and transferred to anitrocellulos
23、e membrane. Blocking was done with 5% skimmilk. Goat anti-ACE2 antibody (AF933, R&D Systems,Minneapolis, MN, USA) in 1:100 dilution was used as theprimary antibody and rabbit anti-goat horseradish peroxi-dase(HRP) (Chemicon, Temecula, CA, USA) in 1:5,000dilution was used as the secondary antibody. T
24、he bandswere visualized by using the enhanced chemiluminescencesystem (PerkinElmer, Boston, MA, USA). Quantitativeanalysis of chemiluminescence was done by using KodakImage Station 2000R with Kodak 1D image analysissoftware (Rochester, NY, USA). ACE2 expressions werecompared in different cells after
25、 normalization by -actinexpressions.Flow cytometry analysisVero E6 and other cells were trypsinized and washed with 1%bovine serum albumin (BSA, Sigma, St. Louis, MO, USA) inphosphate-buffered saline (PBS). Aliquots of 106cells wereincubated in 100 ul PBS with or without 5 ug of ACE2antibody for 60
26、min at 4C. The cells were washed with 1%BSA/PBS and then incubated with fluorescein isothiocyanate(FITC)-conjugated rabbit anti-goat secondary antibody for30 min at 4C. The cells were then fixed with 2%formaldehyde and stored at 4C until analysis. Data wereacquired by the BD FACSCalibur system and a
27、nalysis byCell Quest (BD Bioscience, Franklin Lakes, NJ, USA).Quantitative reverse transcription polymerase chain reaction(qRT-PCR)Supernatants of cell cultures infected with the SARS-CoVwere used for RNA extraction according to the mini spinprotocol of the QIAamp virus RNA mini kit (Qiagen,Hilden,
28、Germany). The extracted RNA was eluted in 50 lRNase-free water, treated with deoxyribonuclease I (LifeTechnologies, Carlsbad, CA, USA) to digest genomicDNA, and stored at 80C before use. Quantitative RT-PCR for SARS-CoV RNA was done by using the RealArt710Eur J Clin Microbiol Infect Dis (2008) 27:70
29、9715HPA-coronavirus LC RT-PCR Reagent (Artus Biotech,Hamburg, Germany) on a LightCycler instrument fromRoche Diagnostics (Mannheim, Germany). Serial dilutionsof the SARS-CoV stock were used as a standard.Real-time RT-PCR was also done to quantify the amountof ACE2 mRNA. A primer pair that extends ov
30、er twoexons of ACE2 (1528-AAAGTGGTGGGAGATGAAGCand 1572-GTTTCATCATGGGGCACA) was used to am-plify an amplicon of 63 nucleotides. A fluorophore andquencher dual-labeled probe (Human #77 from Exiqon,Vedbaek, Denmark) was used on the Roche LightCycler(Roche Diagnostics, Mannheim, Germany). GADPHmRNA was
31、also amplified as an internal control and usedfor normalization with the primer pair CTCATGACCACAGTCCATGC (left) and CCCTGTTGCTGTAGCCAAAT(right).Negative strand-specific RT-PCRNegative strand-specific reverse transcription for SARS-CoV RNA was carried out with 0.1 ug of total RNA, 20units of AMV rev
32、erse transcriptase (Roche Diagnostics,Indianapolis, IN, USA), and the sense primer (BNIoutS2:ATGAATTACCAAGTCAATGGTTAC) 11 at 42C for60 min. PCR with the primer pair ATGAATTACCAAGTCAATGGTTAC(BNIoutS2)andCATAACCAGTCGGTACAGCTA (BNIoutAs) 11 was then performedwith universal cycle conditions (10 min at 9
33、5C, 45 cyclesof 10 s at 95C, 10 s at 55C, and 5 s at 72C) on aLightCycler (Roche Diagnostics, Penzberg, Germany). Theproducts were visualized by ethidium bromide staining afterseparating by 23% agarose gel electrophoresis. Again,GADPH mRNA was also amplified by PCR as an internalcontrol with the pri
34、mer pair CTCATGACCACAGTCCATGC (left) and CCCTGTTGCTGTAGCCAAAT (right).ResultsACE2 expression was silenced in Vero E6 cells by siRNAAfter two consecutive Lipofectamine transfections ofpSilencer-ACE2, Vero E6 cells grew normally (Fig. 2b),with significantly reduced ACE2 expression. Westernblotting sho
35、wed different degrees of ACE2 expressions invarious clones. Clones A4 and C4 both had 99%reductions in ACE2 expressions by Western blotting andwere used for further experiments (Fig. 1a). QuantitativeRT-PCR also revealed 96.296.7% reductions in ACE2mRNA in both clones (Fig. 1b). Flow cytometry furth
36、erFig. 1 ACE2 was silenced by siRNA in Vero E6. a Western blottingof ACE2 in various clones of Vero E6 stably transfected withpSilencer-ACE2, which expressed siRNA targeting ACE2 (lowerpanel). Relative levels of ACE2 expression determined by quantitativeanalysis of chemiluminescence and normalized b
37、y -actin expressionsare shown in the upper panel. Clones A4 and C4 showed the lowestlevels of ACE2 expression. b Quantitative RT-PCR of ACE2 mRNA.The numbers over the bars denote relative copy numbers of ACE2mRNA normalized by GAPDH copy numbers. Clones A4 and C4showed less than 4% of ACE2 mRNA left
38、 in comparison to theoriginal Vero E6 cells. c Expressions of ACE2 in Vero E6 and cloneA4 were determined by flow cytometry. The thin dotted line representsunstained control. ACE2 expression was hardly detectable in themajority of A4 cellsEur J Clin Microbiol Infect Dis (2008) 27:709715711confirmed
39、that ACE2 expression was significantly reducedin clone A4 (Fig. 1c). Repeated Western blotting for ACE2expression after removal of G418 proved that ACE2 ofthese cells were stably silenced (data not shown).Replication of SARS-CoV was blockedin ACE2-silenced cellsInfections of SARS-CoV were done for V
40、ero E6, A4, andC4 cells in a parallel fashion. Figure 2a and b showmorphology of Vero E6 and A4 cells, respectively. Vero E6showed good susceptibility to SARS-CoV. Almost all VeroE6 cells rounded up and died 16 h after inoculation(Fig. 2d). On the other hand, A4 and C4 cells remainedgrossly healthy
41、at 16 h post-inoculation, except for a fewfoci of typical cytopathic effects (Fig. 2e).By using a negative strand RNA-specific primer, thecDNA of the negative strand RNA of SARS-CoV RNAwassynthesized and amplified. A product of 189 base pairs insize was detected in the Vero E6 but not in A4 or C4 ce
42、lls(Fig. 3). SARS-CoV is a positive-stranded RNA virus.Replication of SARS-CoV required synthesis of a negativestrand of SARS-CoV. Inability to detect a negative strandRNA in ACE2-silenced A4 and C4 cells confirmed the lackof SARS-CoV replication in these cells.Production of SARS-CoV was compared be
43、tween VeroE6 and A4 cells by determining SARS-CoV RNA copynumbers with qRT-PCR at various time points afterinoculation (Fig. 4). With the inoculation dose of 1 MOI,SARS-CoV viral loads increased robustly to the sameplateau in both Vero E6 and A4 cells. (Fig. 4a). When theinoculation dose decreased,
44、the velocity of viral amplifica-tion also decreased. At inoculation doses of 101or 102MOI, SARS-CoV replication was significantly delayed inA4 cells. Lower viral loads were demonstrated in A4 thanin Vero E6 at 2448 h post-infection. However, the viralloads reached comparable levels in both cells at
45、72 h post-infection (Fig. 4b,c). When the inoculation dose was furtherdecreased to 103MOI, the virus did not replicate in A4Fig. 2 Inoculation of SARS-CoV resulted in typical cytopath-ic effects in Vero E6 but not A4cells. Microscopic pictures ofVero E6 cells and its ACE2-silenced clone (A4) were ta
46、kenbefore (a, b) and 16 h after(c, d, e) inoculation (h.p.i.)with SARS-CoV. Vero E6 cellsinoculated with medium aloneremained healthy and grew into ahigh density (c). At 16 h post-inoculation of SARS-CoV, al-most all Vero E6 cells roundedup and died (d), while only a fewfoci of typical cytopathic ef
47、fects(arrow in e) were shown inACE2-silenced A4 cells (e)Fig. 3 Negative strand of SARS-CoV RNA was detected in Vero E6cells but not in ACE2-silenced A4 or C4 cells. RT-PCR using negativestrand SARS-CoV RNA-specific primer for was done at 0 and 24 hafter inoculation for Vero E6, A4, and C4 cells. A
48、positive result fornegative strand RNA of SARS-CoV was shown for Vero E6 cells at24 h after inoculation. A4 and C4 cells whose ACE2 had beensilenced showed no negative strand of SARS-CoV. GAPDH wasamplified as an internal control712Eur J Clin Microbiol Infect Dis (2008) 27:709715cells up to 72 h pos
49、t-infection (Fig. 4d). The experimentwas repeated twice with varied viral load readout but thesame trends. The results shown in Fig. 4 were representa-tive of the two independent experiments.DiscussionThe discovery of RNAi, together with development ofmethods for their generation and delivery, has l
50、ed topotential application of RNAi as a novel antiviral approach.Reports regarding inhibition of SARS-CoV by RNAi areaccumulating 1221 and reviewed elsewhere 22, 23.Using viral receptors or coreceptors as targets in inhibitingviral replication has also been tested for certain viruses,such as human i
51、mmunodeficiency virus (HIV) 24, 25. Toour knowledge, however, this is the first study to test thefeasibility of blocking SARS-CoV infections by siRNAtargeting its cellular receptor, ACE2.In several earlier studies testing the susceptibility ofvarious permanent and primary eukaryotic cell lines toSAR
52、S-CoV, ACE2 mRNA could be detected in all of thesusceptible cell lines and its abundance correlated withSARS-CoV susceptibility 2628. On the other hand,refractory cell lines were made permissive to SARS-CoVby the exogenous expression of ACE2 29. Our studyextended these observations by showing that S
53、ARS-CoVsusceptibility was reduced in Vero E6 cells as the ACE2mRNA was reduced by siRNA.Although successful silencing of ACE2 and reduction ofsusceptibility to SARS-CoV were shown in the currentstudy, obstacles exist in clinical usage of RNAi-mediatedACE2 silencing as a preventive or therapeutic mod
54、ality forSARS-CoV infections. The blocking effects of ACE2silencing appeared to be modest. In our experiments withan inoculation dose of 101to 102MOI, viral loadsreachednearlynormallevels72hpost-inoculation(Fig.4b,c),suggesting as low as 4% of ACE2 expression (Fig. 1) issufficient to support entry o
55、f SARS-CoV particles adequateto produce equivalent viral loads at 72 h. The presence ofsome other cellular receptor(s) for SARS-CoV is anotherpossible explanation for the failure in blocking SARS-CoVreplication at higher inoculations. CD209L was reported tobe a minor receptor for SARS-CoV and has pr
56、oved thepossibility 30.The efficacy of ACE2 silencing could theoretically beenhanced by choosing different targets, or using a “multiple-hit” approach by incorporating several siRNAs targetingvarious RNA sequences of SARS-CoVand its receptor(s) atthe same time might be useful. Synergistic effects of
57、 morethan one siRNA targeting different genes of SARS-CoVhave been observed 31. Besides, a recent study showedthat interleukin (IL)-4 and interferon (IFN)-gamma candownregulate ACE2 expression on the cell surface andinhibit SARS-CoV replication 32. “Cocktail” approachesby coadministration of RNAi an
58、d non-RNAi strategies tosuppress ACE2 expression might maximize clinical effec-tiveness and hence have potential therapeutic applications.Fig. 4 Replication of SARS-CoV was blocked in ACE2-silenced A4cells at low inoculation doses. Viral loads of SARS-CoV weredetermined by real-time RT-PCR in Vero E
59、6 and A4 cells withdifferent inoculation doses at different time points. a At theinoculation dose of 1 MOI, no difference in viral loads was notedbetween Vero E6 and A4 cells at various time points. The velocities ofSARS-CoV replication were significantly lower in A4 cells than inVero E6 with the in
60、oculation doses of 101MOI (b) and 102MOI (c).When the inoculation dose was decreased to 103MOI, no increase inviral load was noted in A4 cells, while viral load increased to normallevels at 72 h in Vero E6 (d)Eur J Clin Microbiol Infect Dis (2008) 27:709715713Another concern about translating the cu
61、rrent results to aclinically relevant context is that ACE2 was reported to bean essential regulator of cardiac function 33, 34. ACE2knockout mice showed cardiac dysfunction 34. Selectiveelimination of ACE2 in organs vulnerable to SARS-CoVhas never been tested in vivo and could possibly lead tounexpe
62、cted consequences.In summary, through siRNA technology, we havespecifically silenced ACE2, the cellular receptor forSARS-CoV, in Vero E6 cells. Replication of SARS-CoVwas reduced in these ACE2-silenced cells. The hypothesisthat eliminating ACE2 can reduce or block SARS-CoVinfections was proved to be
63、 true. However, considering themodest effect observed and concerns raised above, applyingsiRNA technology for SARS prevention or therapy requiresfurther efforts.AcknowledgmentsThis study was supported by research grantfrom the National Taiwan University Hospital (NTUH94A16). Thefunding source had no
64、 involvement in study design; collection,analysis, and interpretation of data; the writing of the report; and thedecision to submit the paper for publication.ConflictofintereststatementAllauthorsdeclarenoconflictofinterest.References1. Groneberg DA, Poutanen SM, Low DE, Lode H, Welte T, Zabel P(2005
65、) Treatment and vaccines for severe acute respiratorysyndrome. Lancet Infect Dis 5:1471552. Hsueh PR, Hsiao CH, Yeh SH et al (2003) Microbiologiccharacteristics, serologic responses, and clinical manifestations insevere acute respiratory syndrome, Taiwan. Emerg Infect Dis9:116311673. Gallagher TM, B
66、uchmeier MJ (2001) Coronavirus spike proteinsin viral entry and pathogenesis. Virology 279:3713744. Li W, Moore MJ, Vasilieva N et al (2003) Angiotensin-convertingenzyme 2 is a functional receptor for the SARS coronavirus.Nature 426:4504545. Donoghue M, Hsieh F, Baronas E et al (2000) A novelangiote
67、nsin-converting enzyme-related carboxypeptidase (ACE2)converts angiotensin I to angiotensin 19. Circ Res 87:E1E96. Harmer D, Gilbert M, Borman R, Clark KL (2002) QuantitativemRNA expression profiling of ACE 2, a novel homologue ofangiotensin converting enzyme. FEBS Lett 532:1071107. Agrawal N, Dasar
68、adhi PV, Mohmmed A, Malhotra P, BhatnagarRK, Mukherjee SK (2003) RNA interference: biology, mecha-nism, and applications. Microbiol Mol Biol Rev 67:6576858. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC(1998) Potent and specific genetic interference by double-strandedRNA in Caenorhabdi
69、tis elegans. Nature 391:8068119. Voinnet O (2005) Induction and suppression of RNA silencing:insights from viral infections. Nat Rev Genet 6:20622010. Ksiazek TG, Erdman D, Goldsmith CS et al (2003) A novelcoronavirus associated with severe acute respiratory syndrome.N Engl J Med 348:1953196611. Dro
70、sten C, Gunther S, Preiser W et al (2003) Identification of anovel coronavirus in patients with severe acute respiratorysyndrome. N Engl J Med 348:1967197612. Li T, Zhang Y, Fu L et al (2005) siRNA targeting the leadersequence of SARS-CoV inhibits virus replication. Gene Ther12:75176113. Qin ZL, Zha
71、o P, Zhang XL et al (2004) Silencing of SARS-CoVspike gene by small interfering RNA in HEK 293Tcells. BiochemBiophys Res Commun 324:1186119314. Zhang Y, Li T, Fu L et al (2004) Silencing SARS-CoV Spikeprotein expression in cultured cells by RNA interference. FEBSLett 560:14114615. Shi Y, Yang DH, Xi
72、ong J, Jia J, Huang B, Jin YX (2005)Inhibition of genes expression of SARS coronavirus by syntheticsmall interfering RNAs. Cell Res 15:19320016. Qin ZL, Zhao P, Cao MM, Qi ZT (2007) siRNAs targetingterminal sequences of the SARS-associated coronavirus mem-brane gene inhibit M protein expression thro
73、ugh degradation of MmRNA. J Virol Methods 145:14615417. Wang Z, Ren L, Zhao X et al (2004) Inhibition of severe acuterespiratory syndrome virus replication by small interfering RNAsin mammalian cells. J Virol 78:7523752718. Ni B, Shi X, Li Y, Gao W, Wang X, Wu Y (2005) Inhibition ofreplication and i
74、nfection of severe acute respiratory syndrome-associated coronavirus with plasmid-mediated interference RNA.Antivir Ther 10:52753319. Akerstrom S, Mirazimi A, Tan YJ (2007) Inhibition of SARS-CoV replication cycle by small interference RNAs silencingspecific SARS proteins, 7a/7b, 3a/3b and S. Antivi
75、ral Res73:21922720. Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL (2005) Inhibitionof SARS-CoV replication by siRNA. Antiviral Res 65:454821. Li BJ, Tang Q, Cheng D et al (2005) Using siRNA in prophylacticand therapeutic regimens against SARS coronavirus in Rhesusmacaque. Nat Med 11:94495122. Wu CJ, Cha
76、n YL (2006) Antiviral applications of RNAi forcoronavirus. Expert Opin Investig Drugs 15:899723. Chang Z, Babiuk LA, Hu J (2007) Therapeutic and prophylacticpotential of small interfering RNAs against severe acute respira-tory syndrome: progress to date. BioDrugs 21:91524. Anderson J, Akkina R (2005
77、) CXCR4 and CCR5 shRNAtransgenic CD34+ cell derived macrophages are functionallynormal and resist HIV-1 infection. Retrovirology 2:5325. Novina CD, Murray MF, Dykxhoorn DM et al (2002) siRNA-directed inhibition of HIV-1 infection. Nat Med 8:68168626. Hattermann K, Muller MA, Nitsche A, Wendt S, Dono
78、so Mantke O,Niedrig M (2005) Susceptibility of different eukaryotic cell lines toSARS-coronavirus. Arch Virol 150:1023103127. Hofmann H, Geier M, Marzi A et al (2004) Susceptibility toSARS coronavirus S protein-driven infection correlates withexpression of angiotensin converting enzyme 2 and infecti
79、on canbe blocked by soluble receptor. Biochem Biophys Res Commun319:1216122128. Nie Y, Wang P, Shi X et al (2004) Highly infectious SARS-CoVpseudotyped virus reveals the cell tropism and its correlation withreceptor expression. Biochem Biophys Res Commun 321:994100029. Mossel EC, Huang C, Narayanan
80、K, Makino S, Tesh RB, PetersCJ (2005) Exogenous ACE2 expression allows refractory celllines to support severe acute respiratory syndrome coronavirusreplication. J Virol 79:3846385030. Jeffers SA, Tusell SM, Gillim-Ross L et al (2004) CD209L (L-SIGN) is a receptor for severe acute respiratory syndrom
81、ecoronavirus. Proc Natl Acad Sci USA 101:1574815753714Eur J Clin Microbiol Infect Dis (2008) 27:70971531. He ML, Zheng BJ, Chen Y et al (2006) Kinetics and synergisticeffects of siRNAs targeting structural and replicase genes ofSARS-associated coronavirus. FEBS Lett 580:2414242032. deLang A, Osterha
82、us AD, Haagmans BL (2006) Interferon-gammaand interleukin-4 downregulate expression of the SARS coronavi-rus receptor ACE2 in Vero E6 cells. Virology 353:47448133. Goulter AB, Goddard MJ, Allen JC, Clark KL (2004) ACE2 geneexpression is up-regulated in the human failing heart. BMC Med2:1934. Crackower MA, Sarao R, Oudit GY et al (2002) Angiotensin-converting enzyme 2 is an essential regulator of heart function.Nature 417:822828Eur J Clin Microbiol Infect Dis (2008) 27:709715715
